85
|
Thermo Fisher
pri mirna hsa mir 29a hs03302672 pri Pri Mirna Hsa Mir 29a Hs03302672 Pri, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmids+expressing+mir29a+b1/Pri-miRNA+hsa-mir-29a%2C+Hs03302672_pri/pmc07002266-133-2--1 Average 85 stars, based on 1 article reviews
pri mirna hsa mir 29a hs03302672 pri - by Bioz Stars,
2026-10
85/100 stars
|
Buy from Supplier |
90
|
Shanghai GenePharma
pre-mir-29a/b1 Pre Mir 29a/B1, supplied by Shanghai GenePharma, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmids+expressing+mir29a+b1/pre+mir+29b2+c/pmc05323127-95-27-23 Average 90 stars, based on 1 article reviews
pre-mir-29a/b1 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
91
|
Addgene inc
plasmids expressing mir29a b1 Plasmids Expressing Mir29a B1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/plasmids+expressing+mir29a+b1/pMSCV-PIG-miR-29b-1%2FmiR-29a+(Plasmid+%2364231)/pmc10281530-50-0-27 Average 91 stars, based on 1 article reviews
plasmids expressing mir29a b1 - by Bioz Stars,
2026-10
91/100 stars
|
Buy from Supplier |
N/A
|
hsa-miR-29b-1-5p mimics are small, chemically synthesized double-stranded RNAs that mimic endogenous miRNAs and enable miRNA functional analysis by up-regulation of miRNA activity.
|
Buy from Supplier |
N/A
|
MicroRNA: hsa-miR-29b-1-5p Accession Number: MIMAT0004514 Mature Sequence: GCUGGUUUCAUAUGGUGGUUUAGA hsa-miR-29b-1-5p are small non-coding RNAs of 20-22 nucleotides, typically excised from 60-110 nucleotide foldback RNA precursor structures. miRNAs are involved in crucial biological processes, including development, differentiation,
|
Buy from Supplier |
N/A
|
Hairpin precursor miRNA of approximately 150 nucleotides is cloned into lentiviral or non-viral vectors for delivery in virtually all cell types.
|
Buy from Supplier |